Review



cell lines expi293f cells thermo fisher a14527 recombinant dna pvrc8400 d09 plasmids  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher cell lines expi293f cells thermo fisher a14527 recombinant dna pvrc8400 d09 plasmids
    Cell Lines Expi293f Cells Thermo Fisher A14527 Recombinant Dna Pvrc8400 D09 Plasmids, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expi293f+cells+thermo+fisher/DNA/pm40318633-454-20-24
    Average 99 stars, based on 1 article reviews
    cell lines expi293f cells thermo fisher a14527 recombinant dna pvrc8400 d09 plasmids - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Expressing:

    Article Title: Siglec-9 defines and restrains a natural killer subpopulation highly cytotoxic to HIV-infected cells
    Article Snippet: .. Expi293F cells (Thermo Fisher) were maintained in Expi293 expression medium at 37°C with 8% CO 2 . ..

    Recombinant:

    Article Title: UBR5 forms ligand-dependent complexes on chromatin to regulate nuclear hormone receptor stability.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER SF4 Baculo-Express Media BioConcept Cat# 900F38 3xFLAG peptide Sigma Cat# F4799 Fluorescein NCOA1 peptide aa687-698 FAM-ARHKILHRLLQEGS Peptides & Elephants N/A UBR5 aa244-256 PGEDLMSLLDADI Peptides & Elephants N/A UBR5 aa1098-1110 LQPYLRELLSAKD Peptides & Elephants N/A UBR5 aa1251-1263 RLDLLYRLLTATN Peptides & Elephants N/A UBR5 aa1366-1378 ASSRIGHLLPEEQ Peptides & Elephants N/A UBR5 aa1325-1337 AQLALERVLQDWN Peptides & Elephants N/A UBR5 aa1394-1406 DILLLDTLLGTLV Peptides & Elephants N/A UBR5 aa1794-1806 QISDLMGLIPKYN Peptides & Elephants N/A UBR5 aa2575-2587 MYESLRQLILASQ Peptides & Elephants N/A Deposited data UBR5 structure model (tetramer, WT) This study PDB: 8P83 UBR5 structure model (dimer, Daa522-720) This study PDB: 8P82 UBR5 structure map (tetramer, WT) This study EMDB: 17540 UBR5 structure map (dimer, Daa522-720) This study EMDB: 17539 UBR5 RARA/RXRA negative stain density map This study EMDB: 17542 Whole proteomics (ATRA treatment) This study PXD040953 IPMS (RARA Pulldown) This study PXD041749 Superseries (RARA/UBR5) This study GSE213795 ChIPseq (GR/UBR5) This study GSE213742 RNAseq (ATRA) This study GSE213793 RNAseq (Dexamethasone) This study GSE213793 Experimental models: Cell lines U937-Cas9 Broad GPP N/A NB4-Cas9 Broad GPP N/A .. HEK293T Broad GPP N/A Experimental models: Organisms/strains E. coli BL21-CodonPlus(DE3)-RIL Agilent Cat# 230245 Sf9 Insect cells Thermo Fisher Cat# 11496015 High-Five Insect cells Thermo Fisher Cat# B85502 Expi293F cells Thermo Fisher Cat #A14527 Oligonucleotides Fluorescein-RARE forward/56-FAM/CTCCGG TTCACCGAAAGTTCATAG IDT N/A RARE complement CTATGAACTTTCGGTGAACCGGAG IDT N/A Recombinant DNA pDEST_FLAG-UBR5 This study N/A pDEST_FLAG-UBR5D83-347 (DUBA) This study N/A (Continued on next page) Molecular Cell 83, 2753–2767.e1–e10, August 3, 2023 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pDEST_FLAG-UBR5 (V196K) This study N/A pDEST_FLAG-UBR5D522-720 (Dtandem SBB) This study N/A pDEST_FLAG-UBR5D1181-1243 (DUBR) This study N/A pDEST_FLAG-UBR5D2218-2798 (DHECT) This study N/A pDEST_FLAG-UBR5D522-720,D2218-2798 (Dtandem SBB, DHECT) This study N/A pAC8_Strep-Smt3-TEV-NCOA1 This study N/A pET28a_His-Smt3-TEV-RARA aa175-421 (LBD) This study N/A pET28a_His-Smt3-TEV-RARA aa175-421,V240E (LBD) This study N/A pET28a_His-Smt3-TEV-RARA aa83-421 (DBD-LBD) This study N/A pET28a_His-Smt3-TEV-RXRA aa224-462 (LBD) This study N/A pET28a_His-Smt3-TEV-RXRA aa224-462, V280E (LBD) This study N/A pET28a_His-Smt3-TEV-RXRA aa128-462 (DBD-LBD) This study N/A pET28a_His-Smt3-TEV-ER aa301-552 (LBD) This study N/A pET28a_His-Smt3-TEV-VDR aa118-427 (DBD-LBD) This study N/A pZucchini2_SFFV-RARA-eGFP-IRES-mCherry This study N/A pSquash2_SFFV-eGFP- NR3C1-IRES-mCherry This study N/A pZucchini2_SFFV-RXRA-eGFP-IRES-mCherry This study N/A pZucchini2_SFFV-ESR1-eGFP-IRES-mCherry This study N/A pZucchini2_SFFV-NR1l1-eGFP-IRES-mCherry This study N/A pZucchini2_SFFV-NR3C3-eGFP-IRES-mCherry This study N/A pZucchini2_SFFV-NR3C4-eGFP-IRES-mCherry This study N/A pZucchini2_SFFV-NR1H3-eGFP-IRES-mCherry This study N/A pZucchini2_SFFV-NR1A2-eGFP-IRES-mCherry This study N/A Software and algorithms FEI EPU v2.7.0 Thermo Scientific https://www.thermofisher.com/ cryoFLARE Schenk et al.62 https://www.cryoflare.org/ cryoSPARC v3-v4 Punjani et al.63 https://cryosparc.com/ LocScale Jakobi et al.64 https://git.embl.de/jakobi/ LocScale AlphaFold v2 Jumper et al.65 https://github.com/deepmind/ alphafold Isolde v1.3 Croll66 https://isolde.cimr.cam.ac.uk/ Phenix v1.20 Afonine et al.67 https://phenix-online.org/ ChimeraX v1.3 Pettersen et al.68 https://www.rbvi.ucsf.edu/ chimerax/ PyMol v2.3.3 Schrodinger, LLC https://pymol.org/2/ Rosetta Wang et al.69 https://www.rosettacommons.org/ coot v0.9.6 Emsley et al.70 https://www2.mrc-lmb.cam.ac.uk/ personal/pemsley/coot/ Other HisTrap FF Cytiva Cat# 17525501 Mono Q 5/50 GL Cytiva Cat# 17516601 Superose 6 10/300 Increase Cytiva Cat# 29091596 Expi293 Expression System Kit Thermo Fisher Cat# A14635 FLAG M2 gel Sigma Cat# A2220 Formvar/Carbon 300 mesh copper grids Ted Pella Cat# 01753-F GFP-Trap Magnetic Agarose beads ChromoTek Cat#: GTMA-20 e3 Molecular Cell 83, 2753–2767.e1–e10, August 3, 2023



    Similar Products

    99
    ATCC cell lines bhk cell atcc ccl 10 expi293f thermo fisher scientific a39250 hek293t cell atcc crl 3216 hela hdpp4 hace2 cells
    Cell Lines Bhk Cell Atcc Ccl 10 Expi293f Thermo Fisher Scientific A39250 Hek293t Cell Atcc Crl 3216 Hela Hdpp4 Hace2 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expi293f+cells+thermo+fisher/293T/pm38175758-387-120-124
    Average 99 stars, based on 1 article reviews
    cell lines bhk cell atcc ccl 10 expi293f thermo fisher scientific a39250 hek293t cell atcc crl 3216 hela hdpp4 hace2 cells - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher cell lines expi293f cells thermo fisher a14527 recombinant dna pvrc8400 d09 plasmids
    Cell Lines Expi293f Cells Thermo Fisher A14527 Recombinant Dna Pvrc8400 D09 Plasmids, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expi293f+cells+thermo+fisher/DNA/pm40318633-454-20-24
    Average 99 stars, based on 1 article reviews
    cell lines expi293f cells thermo fisher a14527 recombinant dna pvrc8400 d09 plasmids - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    90
    Thermo Fisher expi293f cells thermo fisher a14635
    Expi293f Cells Thermo Fisher A14635, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expi293f+cells+thermo+fisher/expi293f+cells/pm37861473-197-11-13
    Average 90 stars, based on 1 article reviews
    expi293f cells thermo fisher a14635 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    86
    Thermo Fisher expi293f cells thermo fisher scientific cat
    Expi293f Cells Thermo Fisher Scientific Cat, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expi293f+cells+thermo+fisher/pm36708513-593-91-93
    Average 86 stars, based on 1 article reviews
    expi293f cells thermo fisher scientific cat - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    99
    ATCC crl 3022 homo sapiens expi293f cells thermo fisher scientific
    Crl 3022 Homo Sapiens Expi293f Cells Thermo Fisher Scientific, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expi293f+cells+thermo+fisher/HEK293S+GnTI/pm37633268-598-200-214
    Average 99 stars, based on 1 article reviews
    crl 3022 homo sapiens expi293f cells thermo fisher scientific - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    90
    Thermo Fisher expi293f cells thermo fisher
    Expi293f Cells Thermo Fisher, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expi293f+cells+thermo+fisher/expi293f+cells/pm37478846-758-26-29
    Average 90 stars, based on 1 article reviews
    expi293f cells thermo fisher - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher cell lines 293f freestyle cells thermo fisher k900001 expi293f cells thermo fisher a14527 recombinant dna pvrc8400 1b06 plasmids
    Cell Lines 293f Freestyle Cells Thermo Fisher K900001 Expi293f Cells Thermo Fisher A14527 Recombinant Dna Pvrc8400 1b06 Plasmids, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expi293f+cells+thermo+fisher/DNA/pm37436899-214-38-43
    Average 99 stars, based on 1 article reviews
    cell lines 293f freestyle cells thermo fisher k900001 expi293f cells thermo fisher a14527 recombinant dna pvrc8400 1b06 plasmids - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    86
    Thermo Fisher cell lines expi293f cells thermo fisher cat
    Cell Lines Expi293f Cells Thermo Fisher Cat, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expi293f+cells+thermo+fisher/pm36907502-1031-172-176
    Average 86 stars, based on 1 article reviews
    cell lines expi293f cells thermo fisher cat - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Thermo Fisher ihw00001 expi293f cells thermo fisher scientific
    Ihw00001 Expi293f Cells Thermo Fisher Scientific, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expi293f+cells+thermo+fisher/pm36656713-573-124-127
    Average 86 stars, based on 1 article reviews
    ihw00001 expi293f cells thermo fisher scientific - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    86
    Thermo Fisher crl 3216 expi293f cells thermo fisher scientific
    Crl 3216 Expi293f Cells Thermo Fisher Scientific, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expi293f+cells+thermo+fisher/pm36626903-587-256-259
    Average 86 stars, based on 1 article reviews
    crl 3216 expi293f cells thermo fisher scientific - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    Image Search Results